WhatsApp do Vestiprovas
Compartilhar

Responder Questão:

São Paulo UNIFESP 2010.2 Questão: 23 Biologia Genética 

No ano de 2009, o mundo foi alvo da pandemia provocada pelo vírus influenza A (H1N1), causando perdas econômicas, sociais e de vidas. O referido vírus possui, além de seus receptores protéicos, uma bicamada lipídica e um genoma constituído de 8 genes de RNA. Considerando:

1. a sequência inicial de RNA mensageiro referente a um dos genes deste vírus:

5’                                                       3’
AAAUGCGUUACGAAUGGUAUGCCUACUGAAU


2. a tabela com os códons representativos do código genético universal:


responda:
a) Qual será a sequência de aminoácidos que resultará da tradução da sequência inicial de RNA mensageiro, referente a um dos genes deste vírus indicada em 1?

b) Considerando os mecanismos de replicação do genoma viral, qual a principal diferença entre o vírus da gripe e o vírus que causa a AIDS?



TEMPO NA QUESTÃO

Relógio00:00:00

Gráfico de barras Meu Desempenho

Biologia Genética

Total de Questões: ?

Respondidas: ? (0,00%)

Certas: ? (0,00%)

Erradas: ? (0,00%)

Somente usuários cadastrados!

Postar dúvida ou solução ...