WhatsApp do Vestiprovas
Compartilhar

Responder Questão:

Goiás UFG 2013.1 1ª Fase Questão: 30 Matemática Grandezas e Proporções 

Observe a sequência de bases nitrogenadas de um fragmento de DNA apresentado a seguir.

                               TACAAGGTTCTTTGACTATAATTAGCATTC

A sequência resultante da transcrição deste fragmento é composta de



TEMPO NA QUESTÃO

Relógio00:00:00

Gráfico de barras Meu Desempenho

Matemática Grandezas e Proporções

Total de Questões: ?

Respondidas: ? (0,00%)

Certas: ? (0,00%)

Erradas: ? (0,00%)

Somente usuários cadastrados!

Postar dúvida ou solução ...